Malaysia Sports Essay Example

Malaysia Sports Essay Sports in Malaysia A General Overview When asked about what needs to be done to encourage youths in this country to be involved in sports, ex-Olympian and International Sports Official, Datuk Dr Mani Jegathesan says it is absolutely crucial that we push for a healthy lifestyle, including physical activity, for all Malaysians, especially the youth. â€Å"They are our future, life habits and skills are best inculcated in the formative years†, he adds. A time-tested method for encouraging physical activity is the practice of sport. Sport brings not just the exercise component, but psychological and social benefits as well. Sport is fun, exciting and engaging, and sports can teach us many good values. † It is no surprise that Dr Jegathesan. s view concurs that the schools and the community, in which the youth work and play, would be the best place to strongly advocate this by first making the programmes attractive and compelling to attract the young people. Instead of engaging themselves in some anti-social behaviours, their involvement in all kinds of sports will help develop a healthier generation of young Malaysians with a more confident, competitive and positive outlook in life. Hence, the recent decision by the Education Ministry to slash the annual allocation to the Malaysian Schools Sports Council (MSSM) from RM6 million to RM1. 5 million is definitely a bane to the promotion of sports among the young people in the midst of rising anti-social behaviours. Where there used to be 24 sports, catering for the Under-12, Under-15 and Under-18, now a number of these sports have to be slashed to nearly half of the number of sports. A number of sports like handball, rugby, sailing, table tennis, cricket, softball, cross country, chess, bowling, squash and archery have been axed from the programme. Some of these are the sports such as squash, bowling and archery have put Malaysia on the world map, having produced current world squash champion Datuk Nicol David. Both Shalin Zulkifli (Bowling) and Cheng Chu Sian (Archery) had won the recurve individual gold at the recent SEA Games in Laos. We will write a custom essay sample on Malaysia Sports specifically for you for only $16.38 $13.9/page Order now We will write a custom essay sample on Malaysia Sports specifically for you FOR ONLY $16.38 $13.9/page Hire Writer We will write a custom essay sample on Malaysia Sports specifically for you FOR ONLY $16.38 $13.9/page Hire Writer Besides, when we talk about the 10 merit points allocated to students to gain entry into local universities, the students, who are active in the 11 sports axed by the MSSM, will be at a greater disadvantage. In short, before we talk about going for Gold, we should be talking about investing in the development of young sportsmen and women, in the process help the young people at large develop good social and inter-personal soft skills,besides cultivating a healthy eating habit based on good knowledge of nutrition. All this has to begin at the school level, and we can never go wrong if both the government and the parents of these children put serious efforts to encourage their children to actively participate in sports. Sports in Personality Development Parents, who generally place more emphasis on academic excellence, should realize that their childrens involvement in sports is more than just the ability to play a game. Participation in the sports helps the young people to learn to be in control of various challenging situations and in the process develop a healthy and positive outlook in life. Some of them will eventually learn to be good leaders in their respective fields when they grow up. EDITORIAL EDITORIAL Involvement in the sports also helps to boost up both physical and mental stamina in children. Studies have shown that participation in school sports is vital for the development of motor skills besides helping to release endorphins which helps decrease depression and increases energy. Because the young people are taught to accept defeat in life at a very young age, they eventually develop a stronger determination to succeed in their next attempt. They learn to push beyond their human limitations and trust in their ability to break world records. They say, world champions are made, not born. This is where young people also learn that, in order to win, they will always have to play by the rules. As they advance in their sports as professional sportsmen and sportswomen, they know their rules by hard. The moment a rule is broken, there is a penalty, and in some cases, the athlete may be totally disqualified altogether. Even a year after they are eventually found guilty of foul play, their hard-earned championship title can be withdrawn indefinitely. The rules in a game are the same as the rules in real life which they can ill-afford to overlook. It is this kind of holistic development of the personality of their children and their ability to meet challenges in life that is more important, which like race relations cannot be taught in the classrooms. Sports in Social Benefits and Race Relations In a multi-racial society like Malaysia, young people learn best to bond with each other and people of other races at an early age, when they are on the playground. It is a more effective way to inculcate race relations than having classroom lectures on race relations. When the late Mokhtar Dahari scored a goal, everyone cheered. When Nicol David won the World Squash Championship, her name was mentioned on everyone. s lips. Other well-known names – the late Santokh Singh, Marina Chin, Lee Chong Wei, Misbun Sidek and the list goes on and on – have similarly made the nation proud of their individual achievements. Malaysians are proud of the advancements in sports made by their fellow citizens, regardless of race, religion or creed. For this reason, the government should channel more funds to build good sport facilities for the schools, and focus on promoting participation of the young people in various types of sports as part of the extra-curricular activities. The spirit of comradeship in sports at the school level will eventually help to foster greater race relations in a multi-racial society like ours. A talented young man of 17, Philippe Yang from Sri KL Private School, who had a chance to visit a few public schools in Australia, recently gave a moving speech to his fellow students about his observations how the schools in Australia are generally better equipped with good sports facilities compared to schools in Malaysia. At the conclusion of his speech, Yang urged the Ministry of Education to spend more on providing good sports facilities for the schools. â€Å"I believe†, he said with convictions, â€Å"that Malaysians can do better at sports if they started early in life†. One other area which is very much neglected in the schools nationwide is a better understanding of nutrition, in particular, about the correct way of eating to achieve maximum performance in competitive sports. MALAYSIA SPORTS FITNESS DIRECTORY 2010/2011 MALAYSIA SPORTS FITNESS DIRECTORY 2010/2011 Sports Nutrition Close consultation with the nutritionist is important. Sadly, except for the sports schools, most urban schools do not even have nutritionists who are assigned to take care of the children’s food consumption. As a result, the young people are ill-advised on their daily diet. Junk and fast food has become very popular in schools globally, including Malaysia. That has recently prompted the Taiwanese Government to consider introducing junk food tax to reduce obesity amongst the country. s school-going children. Statistics show that 25-30% of children in that country are obese. In Malaysia, at least 27% of the 25 million people are obese. Our children are no better – and this is an alarming situation for a country with a young population. Analyst such as Malaysian Association for the Study of Obesity president Dr Mohd Ismail Noor opined that efforts to ban fast-food advertisements will not make any impact on the way society eats. A good habit of eating the right diet and frequent exercise has to be cultivated and taught from young. Perhaps, a proper diet, without the excesses of the fast food of modern days, is one possible reason why the country could produce great sportsmen and sportswomen in badminton, football and hockey in the hey days of these sports, at a time when Malaysia was emerging as a nation. Today. s diet is a bane and probably a contributing factor for the lack of exercise and the determination to excel in sports. A proverb may be true after all: â€Å"You are what you eat! † To achieve peak performance in sports, the young athletes will have to follow guidelines that are particularly designed for their kind of activities. A good nutrition plan also includes the proper timing in food consumption. Nutritionists will be able to advise the young athletes how to time their meals to their training, so that the energy peaks at the right time when it is most needed. Meanwhile, apart from looking at the long term goal of developing the younger generation of Malaysians to become world-class athletes, the government also has to study how to further improve the performance of our athletes in some international events, especially those that the country is taking great effort to bid for and host the events. Except for a handful of good athletes, the nation. s performance in some of these international sport events for the past two decades is hardly enviable. Proper resources channelled into the training of our sportsmen and sportswomen will hopefully help to propel our athletes into greater heights of achievements. In some areas, there are apparently improvements being made, but more efforts need to be focused on turning the ashes into the glory of winning World Championships. The six million Ringgit question: Will our involvement in the upcoming major sports events bring a greater fame or disgrace to the country? It is unfair to blame it on the sportsmen and sportswomen alone, as it is a question that also involves the sports administrators, the government, and the sports fans. Are we giving enough support, morally and financially, to help boost the performance of our sports community? Thomas Uber Cup 2010 Malaysia has won the bid to host the 2010 Thomas and Uber Cup Finals in May 2010, beating two others, China and Brazil, which also offered to play host to the two Team World Badminton Championships. This would be the 26th tournament of the Thomas Cup since its debut in 1948, and the 23rd edition of the Uber Cup since 1956. In badminton, despite its late entry into the competition, China. s emergence as a tough competitor is something to emulate. The 2008 Thomas Cup last contested in Jakarta, Indonesia rom May 11 to May 18, 2008, saw Malaysia losing to China 2-3 in the semi-finals. Meanwhile, in the finals, China beat Korea 3-1 and won the championship title for the seventh time in the World Mens Team Championship. Malaysia has won the championship title for five times, the last 3 EDITORIAL EDITORIAL being in 1992 when Malaysia played host. The biggest ch allenge is for Malaysia to take on the world, and prove herself as capable to match China. s performance by winning another world championship on home ground. In the Uber Cup, Malaysia has never won any championship titles; will our shuttlers be able to at least improve their erformance, if not able to win the championship title? To date, only four nations namely China, Japan, USA and Indonesia have won the Uber Cup, and Malaysia is still a long way to go in boosting its all-women. s team. Our team can make it, if they put their heart and soul to winning the Uber Cup championship for the first time. To date, Indonesia still holds the record of being the most successful country in the Thomas Cup, having won the event 13 times while China dominated the Uber Cup with ten championships to their name. Whether Malaysia will once again win the much coveted Thomas Cup world championship is something that many are waiting o see since the event is held on its home ground, especially since it has some of the best shuttlers in the world. For example, Datuk Lee Chong Wei recently managed to clinch his sixth Malaysia Open Super Series title after beatin g Thailands Ponsana Boonsak 21-13, 21-7 in 34 minutes in the final held at the Putra Stadium in Bukit Jalil. He had earlier emerged champion in the Korean Open, and is considered World No. 1. His success is something to be celebrated. The Champions of THOMAS CUP Indonesia 13 times China 7 times Malaysia (incl. Malaya) 5 times The Champions of UBER CUP China 10 times Japan 5 times U. S. A 3 times Indonesia 3 times 4 25th SEA Games 2009 The 26th SEA Games will be held in Bandung and Semarang, Indonesia in 2011. With one year ahead, Malaysia has to pump in a lot of efforts to regain its glorious moments, considering that its performance in the last SEA Games 2009 in Vientiane, Laos, was hardly enviable. Malaysia came in fourth position after Thailand, Vietnam and Indonesia. This was the lowest final position in 22 years. Compared to both Thailand and Vietnam, the number of medals collected was nearly half the number compared to Thailand. Thailand bagged 86 Gold, 83 Silver and 97 Bronze medals, whereas Malaysia accumulated 0 Gold, 40 Silver and 59 Bronze medals. Even Laos coming in the seventh placing won 33 Gold, 25 Silver and 52 Bronze medals, an achievement that far exceeds its own record of five Gold medals at the last SEA Games in Korat, Thailand in 2007. Table 1: Number of medals collected by countries at 25th SEA GAMES 2009 Country Thailand Gold 86 Silver 83 Bronze 97 Tot al Medal 266 Vietnam 83 75 57 215 Indonesia 43 53 74 170 Malaysia 40 40 59 139 Philippines 38 35 51 124 Singapore 33 30 35 98 Laos 33 25 52 110 Myanmar 12 22 37 71 Cambodia 3 10 27 40 Brunei 1 1 8 10 Timor Leste 0 0 3 3 Source: www. laoseagames2009. com Meanwhile, host country Laos surprised everyone by its performance in football in the region by reaching the semi-finals, before falling 3-1 to Malaysia. In football, there was reason for celebration. This was the first time that Malaysia won the football Gold dubbed the mother of all Gold medals in both the mens and womens football, after Thailand had been winning the SEA Games crown in mens football for the last eight editions since 1993 while for the women, they were the defending champions. Malaysia managed to knock out Thailand from a place in semi-finals and regained its status as the SEA Games Football Champion, with a 1-0 win over Vietnam in the final. This raises the hope that Malaysian football MALAYSIA SPORTS FITNESS DIRECTORY 2010/2011 MALAYSIA SPORTS FITNESS DIRECTORY 2010/2011 will be returned to its former glory. Will it still perform even better in the Bandung Games in 2011? Other notable achievements in Laos Games include Roslinda Samsu, who became the new Games record holder for Pole Vault Final (Female) with 4. 15 metres, compared to her 4. 10 metres in the 23rd SEA Games in the Philippines in 2005. Meanwhile, Tan Song Hwa managed to achieve Hammer Throw Final (Female) and hit a new Games record with 56. 1 metres after the old record of 53. 35 metres was won during the 23rd SEA Games in the Philippines in 2005. Asian Indoor Games and ASIAD Malaysia came 15th in rank during the recent 3rd Asian Indoor Games 2009, which was held at the newly constructed Hanoi Indoor Athletics Palace. Two other ASEAN countries, Vietnam and Thailand, were amongst the top five countries, w ith Vietnam bagging 42 Gold medals, 30 Silver and 22 Bronze. Even Thailand. s achievement was glamorous, compared to Malaysia. s performance, with 3 Gold medals, 5 Silver and 8 Bronze. With the 4th Asian Indoor Games being planned in 2013, it is hoped that more emphasis ill be placed on producing athletes with greater excellence. Table 2: Number of medals collected based on countries during the 4th Asian Indoor Games 2009 Rank Country Total 1 Peoples Republic of China 48 25 19 92 2 Vietnam 42 30 22 94 3 Kazakhstan 21 16 21 58 4 Thailand 19 17 34 70 5 Iran 17 15 13 45 . . . . . . 15 Malaysia 3 5 8 16 G S B Taken from http://www. vaigoc2009. com During the 15th ASIAD or Asian Games held in Doha, Qatar from December 1 to December 15, 2006, Malaysia came in the eighth position, with a total of 8 Gold, 17 Silver and 17 Bronze medals. The next Asian Games, to be held in Guangzhou, China from November 12, 2010 to November 27, 2010 will be another opportunity for Malaysian athletes to prove their worth. With 41 events making it the largest Asian Games ever held since 1951 when the Games made its debut in New Delhi. Malaysia will be sending its football team to compete in the Asian Games, after capturing the championship title in the Laos SEA Games and nearly decades in the doldrums. It is hoped that this new team will help bring back the glories during the days of Santokh Singh, Mokhtar Dahari, Soh Chin Aun and R. Arumugam, a truly multi-racial mix. 2010 Commonwealth Games The 2010 Commonwealth Games from 3-14 October 2010 will see some 6,000 international athletes competing in 17 sports in New Delhi, India. Malaysia is also forming its contingent toparticipate in various sports, including diving andswimming competitions, where three swimmers, Daniel Bego, Siow Yi Ting and Khoo Cai Lin, willbe competing against some of the best swimmersfrom China, Japan and South Korea who arealready of world class status, based on theirresults at the World Championships and Olympics. Laos SEA Games Double goldmedalist, Yeoh Ken Nee will also be competing inthe diving competition at the CommonwealthGames in New Delhi in October. He had earlier won a silver in the 1metre springboard during thelast Commonwealth Games in Melbourne. Cheng Chu Sian, Mohd Izzudin Abdul Rahimand Wan Khalmizam Wan Abdul Aziz have been selected to represent Malaysia as the nationalelite archery team. Meanwhile, the MalaysianAmateur Boxing Federation (MABF) said it ishopeful that its boxers will win medals in the NewDelhi Commonwealth Games in October, after delivering two unexpected gold medals at theLaos SEA Games, when Mohd Farkhan Haron and Fairus Azwan Abdullah won the Middleweight(75kg) and Light Heavyweight (81kg) Competitions, respectively, in the Laos Games. Former top rifle shooter, Mohd Emran Zakariais also planning to make a comeback as acompetitor in the Commonwealth Games afterwatching the lack of performance by the youngerparticipants during the Laos SEA Games. 5 EDITORIAL EDITORIAL While a lot of preparations have gone in, the question is: will we see a quantum leap in Malaysia. s overall performance in the major sports events, including the Olympic Games 2012 in London, after a poor show in the Beijing Summer Olympics 2008? Has sufficient efforts been put in to address our weaknesses and build on our existing strengths? This is where more emphasis as to be placed to improve the prestige of our local sportsmen and sportswomen besides promoting other major events that put the country on the world map, one of which is the Formula One, where Malaysia is still a new player. Formula One In March 2010, all eyes will be on Bahrain where the Formula One race will begin from March 12-14. This will feature among others the sensational comeb ack of seven-time world champion, Michael Schumacher who recently signed a deal for with Mercedes. Some 20 locations around the world have been identified, including the Malaysian Grand Prix which will be held on April 4. Malaysia will have two teams in this coming event. Created by AirAsia. s boss, Tony Fernandes, Malaysia. s Team Lotus F1, represented by veteran Formula One driver Jarno Trulli, Finland. s Heikki Kovalainen and Malaysian Fairuz Fauzy, will also be competing in the race. 35 years old Trulli was formerly racing with Toyota, and since 1997, has completed in 216 races, while Kovalainen, 28 made his debut in 2006 with Renault. Fairuz, 27 has driven in the GP2 series and A1 GP. However, in a recent announcement, Petronas said it was signing up with Mercedes for title sponsorship, after the withdrawal of BMW Sauber. team from F1. This, defended Petronas vice-president of corporate services, Ahmad Nizam Salleh, is decided upon after much deliberation and short-listing four teams -Williams, Sauber, Mercedes and Lotus. Ahmad Nizam explains that Petronas was looking beyond patriotism for its sponsorship to allow greater opportunities for business growth. Although Lotus 1 is a Malaysian team, Ah mad was quoted in The Star recently, saying, â€Å"we believe Mercedes are the ideal partners. Besides their long and established history in motorsport, they have the platform to serve our long-term business plans to expand our lubricants business. With the participation of Schumacher, the turnout at the Malaysian Grand Prix on Sunday 4 April 2010 is expected to swell to 100,000, compared to 60,000 last year. Monsoon Cup The current Monsoon Cup agreement, inked in 2005 between the State Government of Terengganu and the World Match Racing Tour (WMRT) for the prestigious sailing event, will end in 2012. The event, which works as a catalyst for the state. s development, serves as the Malaysian leg for the international event, dubbed â€Å"The Formula One of Sailing†, which was started in 2000 to unite the world. s best match-race regattas under one banner. It has drawn tourists from around the world to the state especially during the monsoon season at the end of the year. More importantly, a total of 1. 21 billion people around the world watched the live telecast of the Monsoon Cup over ESPN in 2006 alone, bringing attention to the state. The racing tour comprises nine events in different locations around the world with the Monsoon Cup being the final leg. Thirteen teams met in the waters off Terengganu from Dec 2 to Dec 6, 2009 to battle for the championship trophy. This event has generated as high as 1. 2 billion viewers on ESPN Star Sports, Fox Australia, CNBC Australia and Pan Asia, Sky New Zealand, America One, Sports Max, Eurosport World, Fox Sports US and Travel Channel China live telecast every year. Skipper Adam Mino prio, his Kiwi crew David Swete, Nick Blackman, Daniel Lean and Tom Powrie of the New Zealands Black Match Racing clinched the 2009 Monsoon Cup, after being crowned the 2009 ISAF Match Racing World Champions and beating three-time (in 1998, 2002 and 2008) Olympic gold medallist and ISAF World 6 Sailor, Ben Ainslie and Team Origin at the Ri-Yaz Heritage Marina Resort and Spa in Pulau Duyong. Yanmar Racing came in the third placing, while two-time winner of Monsoon Cup, Datuk Peter Gilmour came in fourth. 2009 MONSOON CUP RESULTS 1. Adam Minoprio (NZL) ETNZ/Black Match Racing 2. Ben Ainslie (GBR) Team Origin 3. Peter Gilmour (AUS) Yanmar Racing 4. Sebastien Col (FRA) French Match Racing Team All4One 5. Mathieu Richard (FRA) French Match Racing Team 6. Phil Robertson (NZL) Waka Racing 7. Torvar Mirsky (AUS) Mirsky Racing Team 8. Damien Iehl (FRA) French Match Racing Team 9. Magnus Holmberg (SWE) Victory Challenge 10. Francesco Bruni (ITA) Team Azzurra 11. Ian Williams (GBR) Team Pindar 12. Hazwan Hazim Dermawan (MAS) Taring Pelangi Team 2009 WORLD MATCH RACING TOUR RESULTS Adam Minoprio ETNZ Black Match Racing 138 points Torvar Mirsky Mirsky Racing Team 97 points Ben Ainslie Team Origin 95 points Peter Gilmour Yanmar Racing 89 points Mathieu Richard French Match Racing Team 89 points Ian Williams Team Pindar 75 points Sebastien Col French Match Racing Team All4One 59 points Damien Iehl French Match Racing Team 54 points The Creation of New Sports Efforts have also been made to revive traditional sports and to introduce them to the world. With the help of the All Malaysia Traditional Games Heritage Association, traditional games (some of which went back as far as the 15th Century) have been made alive with a close working relationship between the association and various ministries. It has hosted some of the biggest events in Selangor, Penang and Kuala Lumpur since 2001. The pressure exists when host countries also introduce and seek to popularise their traditional sports. Across the region, there is a growing interest in reviving traditional sports, and Malaysia should not be lagging behind. Some of these traditional sports are common in the region, which can be included into the wide spectrum of existing competitions. Some of the other sports are also becoming increasingly popular. In the equestrian sport, the Pahang Penn Endurance Challenge 2009, held at the RM2 million Pahang International Endurance Park in Sungai Baging, Cherating, covering 100 ha of training ground, saw a bigger turnout of spectators. In the event, Shahruddin Abdullah from the Team Blue Moon defeated defending champion, the Yang di-Pertuan Agong Tuanku Mizan Abidin, and emerged champion after completing the route in seven hours, 25 minutes and seven seconds. The event attracted a total of 130 riders from France, Germany, Singapore, Thailand, Indonesia and Malaysia. Putting the Money Where the Mouth is A total of RM2. billion was spent in the 8th Malaysia Plan, while under the 9th Malaysia Plan, a budget allocation of RM2. 4 billion which represents an increase of mere 1. 1% from the previous plan, was approved for the development of sports from 2006-10. This budget requires a great deal of proper management of funds to help achieve the nation. s aspiration to produce more of its world-class sports people such as Malaysias squash queen and world number one Nicol David, who recently sealed her fourth successive Womens World Open title after defeating host nations favourite, Natalie Grinham. Some of the major sports events such at the Monsoon Cup, whose current agreement ends in 2012, should be encouraged to go on because of their ability to attract tourists to this country and it works as a catalyst for the state. s development, while others help to put Malaysia on world map when championship titles are won. At a recent 12th World Sport for All Congressheld in Kuala Lumpur, themed, â€Å"Sport for All – Sport for Life†, where 505 participants from 96countries came together to brainstorm ideas onhow to increase the trend of physical inactivity, the 7 EDITORIAL EDITORIAL delegates arrived unanimously at some keyconclusions: . Focus on the importance of sport and hysical activity as a key element of healthpolicies. . When formulating policies, take into account the public health, social and economicbenefits of increased participation in sportand physical activity. . Recognise the importance of community sport and physical activity. . Consider Sport for All as an investment, not a cost or burden. The re sults of the four-day congress werecompiled into a declaration which underlined theimportance of a partnership between the OlympicMovement and governments to act together tocounter the global problems of decreasingphysical activity and the increasing incidence ofobesity. At another conference, some 500 participants at the 2009 International Conference on Integration of Knowledge Intensive Multi-AgentSystems (KIMAS 2009) learnt that, althoughMalaysia has become the favourite destination forinternational sports events, it has yet to set up adesignated department or unit in related government agencies to monitor the cash flow ofour Ringgit or foreign currencies to see how it iscontributing to our economy. This was a fact whichcould not be denied by the Prime Minister himself. Despite the fact that Malaysia has participated inthe Olympics from as early as 1956 and sportsmarketing is easily worth US$250 billion (RM875billion) globally based on a report in SportsBusiness Journal, the sports and fitness industryin Malaysia is still considered as a â€Å"young andemerging sector†. One of the speakers at the convention, DatukRadha Krishnan, Managing Director of UniversalFitness Leisure (UFL) cited that the biennialSukma Games has an allocation of RM30 to RM40 million for every chapter, yet the moneygenerated from the event was not documented. Compared to New Zealand, with just 4. 3 millionpeople, the country had three per cent or 37,500 of the population involved in the sport industry, where about US$75 billion (RM272 billion) isgenerated annually from the sector. Whereas Malaysia has a dedicated Youth andSports Ministry, National Sports Council andNational Sports Institute, in the United States, themajority of the state sport bodies are run on avoluntarily basis, yet they are able to monitor sixmillion school students and 22,000 high schoolstudents. Moving Ahead It goes without saying that industry players wantto see the sports industry achieve the nextquantum leap. Although the country has achievedsterling feats at the world stage by havingworld-beaters in more than one sport, withbadminton, bowling, squash, cycling and archerybasking in limelight, they say, there is still a lot thatneeds to be done. Much soul searching has to bedone at all levels to see how we can train our sportsmen and women from young and bring thecountry to the next level of sports excellence tobeat world records. This is why the nation has to seriously look atthe overall development of sports from the schoollevel onwards, if we are determined to see our young people emerging as world class champions. It requires a lot of cooperation at alllevels of society. The reality is that sports have notbeen given much emphasis in schools thatprompted the President of the Olympic Council ofMalaysia, Tan Sri Tunku Imran Tuanku Jaafar toexpress his personal disappointment: â€Å"I hopeMalaysians will put into practice what they havelearnt from other successful nations. Unfortunately, Malaysia is lacking concrete examples, especially in schools where somechildren have only one hour of sport a week†. Hisresounding call to greater involvement of thechildren in sports is one area of concern that thegovernment, teachers and parents have toimmediately address. Without a doubt, they haveto view sports as an investment, not a liability or aburden – and continue to encourage the young toparticipate in all sorts of games, apart frommerely focusing on hosting major sports events inMalaysia. 8

Free Essays on Independence

Nations come into being in many ways. Military rebellion, civil strife, acts of heroism, acts of treachery, a thousand greater or lesser clashes between defenders of the old order and supporters of the new. All these occurrences and more have marked the emergences of new nations, large and small. The birth of our nation included them all. That birth was unique, not only in the immensity of its later impact on the course of world history and the growth of democracy, but also because so many of the threads in our national history run back through time to come together in one place, in one time, and in one document: The Declaration of Independence. The clearest call for independence up to the summer of 1776 came in Philadelphia on June seventh. On this day in session the Pennsylvania State House (later Independence Hall), the continental congress heard Richard Henry lee of Virginia read his resolution beginning â€Å"Resolved, that these United Colonies are, and of right ought to be, free, and independent States, that they are absolved from all allegiance to the British Crown, and that all political connection between them and the State of Great Britain is and ought to be totally dissolved.† (Kelly, cs.indiana.edu/statecraft/decl.html, 1997 pg 2 of 13) Lee’s Resolution was an expression of what was already beginning to happen throughout the colonies. When the second Continental Congress, which was essentially the government of the United States from 1775 to 1788, first met in May 1775, King George III had not replied to the petition for redress of grievances that he had been sent by the First Continental Congress. The Congress gradually took on the responsibilities of a national government. In June 1775 the congress established the continental Army as well as a continental currency. By the end of July of that year, it created a post office for the â€Å"United Colonies.† In August 1775 a royal proclamation declared that the Ki... Free Essays on Independence Free Essays on Independence There are many important factors in the Declaration of Independence, which enable the foundation of a new government. These range from describing grievances with England, to how government should be run differently, to the first statement of separation. The first step to the foundation of a new government is the uniting of a people in a common goal. Since all people were feeling violated by English soldiers, it was necessary to state these grievances in order to make people aware that they are not alone. When people learned that others felt the same as them emotion was stirred. The Declaration of Independence listed the grievances such as, â€Å"He has erected a multitude of new offices, and sent hither swarms of officers to harass our people and eat out their substance.† The next important step to the foundation of a new government was to gain peoples ambition by showing how the government would be run if a new party took over. This goal was achieved by stating the rights of man. â€Å"We hold these truths to be self evident: That all men are created equal; that they are endowed by their creator with certain unalienable rights; that among these are life, liberty, and the pursuit of happiness.† This statement made people hopeful and feel kindly toward this new government. The final step in the preparation for a new government was separation from the old government. This was declared twice in the Declaration of Independence. In the beginning, â€Å"That to secure these rights, governments are instituted among men, driving their just powers from the consent of the governed,† and in the end, â€Å"that these united colonies are, and of right ought to be, free and independent states; that they are absolved from all allegiance to the British crown, and that all political connection between them and the state of Great Britain is, and ought to be, totally dissolved. In conclusion, the Declaration of Independence was able to motivate people, give the... Free Essays on Independence Nations come into being in many ways. Military rebellion, civil strife, acts of heroism, acts of treachery, a thousand greater or lesser clashes between defenders of the old order and supporters of the new. All these occurrences and more have marked the emergences of new nations, large and small. The birth of our nation included them all. That birth was unique, not only in the immensity of its later impact on the course of world history and the growth of democracy, but also because so many of the threads in our national history run back through time to come together in one place, in one time, and in one document: The Declaration of Independence. The clearest call for independence up to the summer of 1776 came in Philadelphia on June seventh. On this day in session the Pennsylvania State House (later Independence Hall), the continental congress heard Richard Henry lee of Virginia read his resolution beginning â€Å"Resolved, that these United Colonies are, and of right ought to be, free, and independent States, that they are absolved from all allegiance to the British Crown, and that all political connection between them and the State of Great Britain is and ought to be totally dissolved.† (Kelly, cs.indiana.edu/statecraft/decl.html, 1997 pg 2 of 13) Lee’s Resolution was an expression of what was already beginning to happen throughout the colonies. When the second Continental Congress, which was essentially the government of the United States from 1775 to 1788, first met in May 1775, King George III had not replied to the petition for redress of grievances that he had been sent by the First Continental Congress. The Congress gradually took on the responsibilities of a national government. In June 1775 the congress established the continental Army as well as a continental currency. By the end of July of that year, it created a post office for the â€Å"United Colonies.† In August 1775 a royal proclamation declared that the Ki...

Political sciences Essay Example | Topics and Well Written Essays - 1250 words - 1

Political sciences - Essay Example Before the start of the year, Israel and Palestine resumed their armed conflict, killing thousands of innocent civilians on both sides and displacing thousands of people in Gaza Strip. Armed conflicts resumed as Israel and Palestine unleashed their military offensives to weaken each other’s hold to the embattled territory formerly occupied by the Palestinians. Both warring countries sent regular armies and launched paramilitary groups, an action that alerted the international community. As the international community clamored for the pacification of the region, the Israeli government under the regime of its current prime minister Benjamin Netanyahu and the Palestine Liberation Organization under the political leadership of Mahmoud Abbas, have been conducting a number of negotiations to ease the two-party conflict. Based on historical accounts, the Israel-Palestine conflict started when the United Nation intervened, giving the Jewish people the right to the war-stricken territory. This action resulted in numerous wars, which largely involved international actors, particularly the United States. There are a number of reasons why an Israel-Palestine peace accord that would probably result in the end of armed conflict in the region is hard to achieve. In order to understand why regional peace is far from being achieved in the Middle East, it is important to look at the many obstacles that hinder a final and peaceful cooperation between Israel and Palestine and conclusion to the two-party armed conflict. One of the biggest obstacles to a final and peaceful conclusion to the Israel-Palestine armed conflict is the intensifying Israel lobby in the United States. Israel Lobby is a term being used to describe an absurd alliance of groups, organizations and powerful individuals who vigorously attempt to maneuver American foreign policy that is favorable to Israel (Wittkopf & McCormick 87). Instead of bringing peace to

Emerging Technologies Case Study Example | Topics and Well Written Essays - 750 words

Emerging Technologies - Case Study Example Consequently, this case study highlights the use of intelligent building capabilities, discuss its risks, and recommend how providers can secure this technology. Inclusion of intelligent building capabilities in medical premises In a journal article, Hlousek (2008) contend that intelligent buildings have the capability of responding to the needs of its occupants along with saving on cost and reducing ecological impact. This is one of the motivators that seen people install sensory devices into everyday objects they can place in offices to monitor and provide data about users. The use of such technology has transformed how engineers design intelligent buildings, as pervasive technology continue to evolve over time. Currently, engineers can install various pervasive technologies in buildings such as CCTV cameras and wearable tags. These technologies help gather data about people in intelligent building, which can provide intelligence that can help providers deliver services to users (M oran & Nakata, 2010). The suitability of pervasive technology in proving gathering and transmitting data from users to receiving gadgets has paved way for the use of these technologies in various places. For instance, some parents use these wearable tags to track their children while some buildings have CCTV cameras to monitor people entering and exiting a building. Risks associated with the technologies Pervasive technologies have proved essential in enabling intelligent building users with services. However, there are various risks associated with this emerging technology. The risks associated with pervasive technologies in intelligent building include user perception, privacy concerns, and accuracy, ownership and accessibility. a) Perception: The use of pervasive technologies raises risk on how people perceive these technologies. In a medical environment, the installation of gadgets such as CCTV cameras can alter the behavior of physicians, as well as that of patients. Stress amo ng users is one of the effects of surveillance technologies when users feel they are under observation (Moran & Nakata, 2010). This can affect the performance and behaviors of subjects. b) Privacy concerns: Monitoring technologies such as GPS products and wearable tags have privacy risks. In a work environment, users have concerns on what kind of information employers can gather about their employees (Michael, McNamee & Michael, 2006). In addition, users question what kind of information a provider can view from subjects under surveillance. As a result, such technologies can infringe the privacy of the subjects they are observing. c) Accuracy of data: Increasing reliance of monitoring technologies bears a risk of inaccurate data, which can lead to negative outcomes. Given that, pervasive technologies have become essential in providing critical services; their accuracy is a subject of debate as erroneous data can lead to severe impact (Michael, McNamee & Michael, 2006). For example, accidental data processing for GPS services can lead to negative outcomes because providers can make wrong decisions that have far-reaching effects on patients. d) Ownership of user data: Owners of pervasive tech

Business Regulatory Law Essay Example | Topics and Well Written Essays - 1500 words

Business Regulatory Law - Essay Example The federal government can make arrangements for the protection f the population from the pollution that flows down from other states. The federal government expects the local governments to put into effect national environmental laws, including the Clean Water Act. However, the federal government has some concerns if the state and local governments are not managing the inspections in a timely manner. The federal government also has concerns that the Environmental Protection Agency (EPA) is not following through. A resident f Erehwon, Ms. Kelly Bates has accused Alumina, Inc. f frequently contaminating the waters f Lake Dira with carcinogenic effluents, and has alleged that the consumption f the water is the prime cause f her 10 year old daughter's leukemia. Ms. Bates also alleges that her daughter's illness maybe as old as Alumina's first environmental law violation. The incident occurred five years ago. Alumina Inc. was reported to be in violation f an environmental discharge into Lake Dira. Alumina followed through and cleaned the spill up and the violation was corrected (UOP, 2007). People in a local newspaper, The Erehwon Reporter, seemed to want to keep the fire burning. Kelly Bates threatened to file a $5 million personal injury case against Alumina Inc. to recover compensatory and punitive damages. Ms. Bates alleged that Alumina's careless conduct is the immediate cause f her daughter's illness in though this occurred five years ago and the company has not had any further problems (UOP, 2007). The Scientific report on water pollution has rendered Ms. Bates claim unsubstantiated. Regulations and Legal Issues There are a few very important facts that include regulations and legal issues that are present within the Alumina simulation and they are as follows: Regulation f Business. There should be written roles and regulations that coincide with Federal and State laws. The regulations should be followed at all times with an Environmental supervisor in place to document all key findings. Alumina does not have any written regulations that match with the State and Federal governments at this time. The employees need these practices and references in place to ensure that they are following the laws that have been made. Environmental Policy The National Environmental Policy Act (NEPA) was passed in 1970 along with the Environmental Quality Improvement Act, and the Environmental Protection Agency (EPA). These federal enactments were to put into place to ensure that the environment would be protected against both the public and private actions (Environmental lawyers, 1997). Alumina was reported to be in violation f an environmental discharge into Lake Dira. However, according to the EPA, Alumina quickly responded to the allegation and cleaned-up the Lake. The violation within the organization was promptly corrected and Alumni have not had another incident. Ethical Issues Ethical issues such moral values, beliefs and principles are considered as foundation f civilized society. People follow these values on a day to day basis.

Advantages And Disadvantages Of Joining A Currency Union Economics Essay

Advantages And Disadvantages Of Joining A Currency Union Economics Essay Currency Union are a group of countries that share a single currency. There is a misconception that currency unions are a product of the 20th century globalization, but it is not true. They have existed since the times of Roman, but still they havent been adopted as a global financial system. The reason being despite it having many advantages it has few disadvantages as well. I will discuss these advantages and the disadvantages in the first part of my essay. While in the second part I will show some light on the current heated debate about UK joining the Euro Zone. Transaction cost:- The most essential advantage connected with changing to a single currency was the removal of the need to change currency . Savings are very large because of the elimination of the transaction cost connected to the exchanging currency, the taxes for countries that have most of the exports to the European counties only. The significant decrease in the cost of exports will be most useful for small scale business to achieve economies of scale. By switching to the euro, members of the EMU were expected to save as much as $30 billion a year (The Euro, the European, pp. 154), :- Daniel Portone. Investment:- As there is low transaction cost there is large amount of investment because companies now this is one of the most important decreases in the cross border investment. This has lead to large cross border investment like in France the foreign direct investment has increased from 12% to 18%. The disappearance of the cost of transaction and the introduction of the common currency makes the money market deeper and integrated. The major financial institutes are being listed in the Euro, which in turn attracts potential investors to gain confidence in different EU financial markets . The market combination provides various links to dilute the risk in the EMU. If we assume that the French and German bond and equity markets are fully integrated, it will facilitate the adjustment to asymmetric shocks (see Figure 1). When France is hit by a negative shock, companies there make losses and that drives down stock prices of these companies.- Jean Monnet.which bring the profit to germen investors ,thus the boom in germany brings profit to French . A very similar mechanism also works through the fully integrated bond market, Jean Monnet Exchange rate stability (Common Currency):- Common currency generates a platform to judge the price relationship, make price difference more noticeable and helps to equalise it across borders.- Jean Monnet .Along with the removal of the need to change currency, there is also problem with the volatility of the exchange rates also. When the rate fluctuates it also affects the profitability of the company and increasing the risk which in turn decreases the net investment into the country. Thus to stabilise the situation it is useful for a company to enter in a currency union. .. having the same currency can boost trade by a factor of three. Canada again provides the example : inspire of close proximity to the US and similarities in culture , Canadian provinces trade twelve to twenty times more amongst themselves than with the US states The common currency provides the member nation to compare the prices efficiently . The poor regions would never become richer simply by devaluing its cur rency repeatedly. On the contrary the associated high inflation would introduce economic distortion and reduce its average real income, :- Professor Alec Chrystal Free movement of workers :- Free mobility area of the labour helps the countries to prevent from an asymmetric shock which is the result of inflation in one country A and a recession in country B . If there is mobility of labour ie they can move freely this will lead to release the inflation in A and increasing employment of the people in B. For example, workers from Indonesia, Malaysia, Philippines, and Thailand account for 10 percent of the employment in Singapore. Emigration has been as much as 2 percent of the labor force of the sending countries- (http://www.adb.org/Documents/ERD/Working_Papers/WP012.pdf ) The prevention of competitive devaluations and speculation:- The Monetary unions protect the member countries damaging effect of competitive devaluation of the currency which may lead to steeling the business of the other . But is any country which try to do this with the monetary unions has an adverse effect of high inflation. Other advantages of joining the currency union are as follows. The country gets an access to larger markets and thus increasing the overall income of the country. It also reduces the effect of shocks from exterior instability to an individual country. Joining the currency union is very important for those countries which lack internal control . This allows free movement of goods and sevices without any obstacles. This also keeps peace between the nation as they now that they are all interdependent on each other . the one of the most important advantage is it it will increase the tourism in the countries as there is easy movement and no currency changes . Disadvantages of currency union Loss of sovereignty: This means that country adopting the Common currency has to give up the Monetary policies to the body who is controlling the union . like in the case of European union all the 12 countries had to give up their monetary rights to the European central bank with decides the monetary policies for all the nation . Its most biggest disadvantages come during the crisis when the situation are different in all the different countries and cannot be handled in the same way. Like in a case of sudden increase in the unemployment the governments income will decrease as taxes are not paid so the government will have to increase the taxes which will lead to further disaster decrease in the interest rates during the crisis will help some but will adversely affect the other . So it is very difficult to be in an currency union . In the United States, Texas could not avoid a recession in the wake of the 1986 oil price fall, whereas demand for Sterling changed in the light of the ne w oil price, adjusting the exchange rate downwards.- http://news.bbc.co.uk/1/hi/special_report/single_currency/25081.stm Cost of adopting the new currency: The adopting of new currency will have a very huge cost to the economy. These are like Such changes include educating customers, changing labels, and training staff, changing computer software and adjusting tills.- http://news.bbc.co.uk/1/hi/special_report/single_currency/25081.stm Lower inflation and reduced transactions costs of trade provide gains, while the inability to respond to idiosyncratic asymmetric shocks generate losses.:- Andrew K. Rose1 New negative cross-border spillovers of fiscal policy:- a national fiscal expansion raises the demand for savings, ceteris paribus pushing up the long-run interest rate and discouraging investment. In an integrated capital market strengthened by monetary unification, this effect will spread to other countries, imposing a negative externality. A monetary union may also generate new negative spillovers. An increase in domestic government purchases, in affecting the demand for domestic products, raises local inflation, thereby pushing up average euro-area inflation and forcing the ECB to contract monetary policy for the entire area. Further, a national fiscal expansion may cause an appreciation of the euro, thereby undermining the external competitive position of all union members.- (http://www.voxeu.org/index.php?q=node/4305) The other disadvantages of the Monetary unions are as follows, the one of the biggest disadvantage is the difference in languages with in turn leads to the decrease in the mobility of labour Language in Europe is a huge barrier to labour force mobility. This may lead to pockets of deeply depressed areas in which people cannot find work (http://news.bbc.co.uk/1/hi/special_report/single_currency/25081.stm.). The countries in the currency union also lose the ability to cope with the external shocks. It have to leave it on itself so be rectified with in todays time is very difficult. Should Britain join euro Britain is one of the biggest financial hub in the world, which is also the worlds largest hub for currency trading . Britain does the maximum currency trading . Britain from the beginning has been independent and has been flourishing . But it was a real shock to the Britain when EMU was formed and the biggest threat . After reading the list of journals , it is very difficult to say whether or not Britain should join the Euro or not . There are many arguments and thoughts over it and would like to bring them forward to you . I would first like to bring forward all the positive aspects of the Britain joining the euro with the real facts about it . There has been a significant decrease in foreign direct investment in Britain after the formation of the EMU . Britains share of the foreign direct investment coming into Europe has fallen by a half (see Table 3). In 2001 the Netherlands received more of this investment than Britain.:- Richard Layard, Willem Buiter, Christopher Huhne, Will Hutton, London as mentioned is a important financial hub, but the pound has little to do with it. Where most of the trading is done mostly in dollars in most of the transaction , but the euro outranked the pound ,where euro was involved in 41% and pound in just 24 % of the transactions (as seen in the table 1). The other thing is that this financial centre employ about 1,50,000 people creating  £10- £15billion annual invisible exports . If the UK exercises its opt-out, long-term damage would be inflicted on the City, which will ultimately lose its pre-eminence to Frankfurt or even Paris, in part because trading in the Euro will be focused within its area of operation:- Brian Burkitt The continues increase in the instability will decrease the attractiveness of Britain has as a destination of capital flow. The stock of euro-denominated corporate bonds nearly tripled between 1998 and 2001, to 1.2 trillion Euros. This clearly shows the euro-zone has reconstructed its business which has increased the annual cross border foreign direct investment by 4 fold. Britain almost has its 50% of its trade with the EMU, which is shown in table 2, so it would be better for the UK to join the euro and thus reduce its cost of import and exports .During November 2002 the Chief Executive of Ford UK specifically stated that euro/sterling exchange rates were damaging the profits of the company:- http://www.fpma.scot.nhs.uk/euro_pros_cons.pdf The British consumers will be now able to compare prices all over Europe . This will end the phenomenon of rip-off Britain that allowed coca-cola to charge double here what it charges in Spain, or Ford to charge 43% more for a focus than in Denmark. :- Christopher Huhne . From long time the MNCs new that Britain is the Treasure Island and the consumer are willing to pay high price. Britain chance to exploit the Asia and the America is by joining the bigger currency thats the Euro

A View From The Bridge - What makes a view from the Bridge good :: English Literature

A View From The Bridge - What makes a view from the Bridge 'good' theatre.What techniques does Miller use to create dramatic impact and meaning. Question 2: What makes a view from the Bridge 'good' theatre. What techniques does Miller use to create dramatic impact and meaning Miller uses very clever techniques throughout 'A View from the Bridge'. As most of his plays will show you, he likes to focus his work on different groups in society. In this particular play, he writes about Latino Americans, and there struggle to survive in the Bronx. Characterisation is a key factor to creating tension in 'A view from the Bridge'. Miller uses a lawyer, Alfieri, as a narrator. Alfieri appears at different stages to explain the situation in more detail, he addresses the audience. By doing this the audience begin to trust him, and are more likely to believe what he says. This makes the audience feel more involved, and thus they are more inclined to pay attention. Alfieri links the action between the scenes. He bridges the gap between audience and play. Yet again, this bridge makes the people watching feel more involved. When Alfieri opens the play, he is very light hearted and appears respectable: "You wouldn't have known it, but something amusing has just happened. You see how uneasily they nod to me? That's because I am a lawyer." This beginning makes the audience feel at ease. The audiences first impressions of Alfieri are positive, with him wearing a suit and appearing 'good-humoured' and 'thoughtful'. This trail of thought continues throughout. Alfieri is used as a dramatic device, and not as a person In this play. Although, he does participate in this piece. He smoothly glides between narrator and actor: Stage directions: [Alfieri pauses, looks down at his desk, then to Eddie as though he were continuing a conversation with him] Miller uses complex stage directions which although hard for the character, if performed correctly, produce great theatre. In this particular path he makes Alfieri address the audience before gliding

Qualities that a ‘good’ teacher should have Essay

Task 1 – List 5 qualities that a ‘good’ teacher should have and give reasons for your choices. Which of these qualities do you consider to be more important, and why? 1. a good teacher should really love teaching because in my opinion you cannot be a good teacher if you do not like what you do. 2. a good teacher should be lively and entertaining because children do not like boring teachers, they need somebody who changes learning into pleasure. as my experience schooled children love games and it is one of the best way of encouraging them to take part in the lesson. 3. a good teacher is able to motivate learners as motivation is one of the most important aspects while learning. children who are well motivated are eager to learn thus they learn more. 4. a good teacher should have good rapport and interaction with the class because it is crucial to have a nice atmosphere in the classroom. I believe that children cannot be scared of the teacher, they must like him/her and then they are open and more involved in the lessons. 5. a good teacher should be able to correct student without offending them or affecting their motivation as if he/she does it then the children do not want to take part in the lessons because they are scared of making mistakes. i always tell my students that they shouldn’t be scared of making mistakes as nobody is perfect and I’m there to correct them. and explain that they are learners so they can’t know all of the answers correctly. As far as I am concerned, I really believe that all of the qualities I chose are equal. you really need to have all of them to be a good teacher. it is really difficult for me to decide which one is more important and which one is less important. Task 2 – State what you consider to be the five most important roles of a teacher. Describe each role and say why you think it is important. 1. organizer – teacher organizes to do various activities. it is important as children need instruction, need to be organized into groups or pairs. teacher must initiate and finish activities and give feedback. 2. participant – teacher participates in the lesson as an equal. it is good  method as children can see that the teacher wants to be a part of the class so it is a good way of gaining trust. 3. observer – teacher monitors what is going on in the classroom. it is important as teacher must know the improvement of the students and what needs to be revise. 4. model – teacher (native speaker) is the source of real, live English. it is important because sometimes it is the only way for the students to encounter foreign language with foreign accent. native speaker is also a good source of cultural information. 5. assessor – teacher gives feedback, correction, evaluates and grades. children want to know whether they make mistakes or not, as they want to improve their skills and try not to make the same mistake again. Task 3 – List 5 qualities you would expect to find in a ‘good’ learner. Which of these qualities do you consider to be more important, and why? 1. a desire to learn – it is crucial to want to learn a language as if the students find learning language useless they simply don’t want to take part in any activities and they don’t want to study. 2. a willingness to ask questions – students must ask questions as it is the way of finding more information and also practise their speaking skills. 3. a willingness to listen to the language – listening to the language can improve not only listening but also speaking skills. it also helps to gain foreign accent. 4. an ability to think about their own learning process and methods – every students is different and prefers different methods of learning. it is important for students to realize which method is the most helpful and useful for them while learning language. 5. an acceptance of error correction – students must realize that when teacher corrects them he/she does it not to embarrass them but to improve their learning. students should try not to make the same mistakes over and over again. Task 4 – What are some of the major differences you would expect to find between adult and young learners? Young learners are sometimes less motivated than adults. what is more, young learners are more receptive to the new sounds and grammar. it is widely known that young learners can acquire foreign language faster than adults.  adults has longer history of learning experience than young learners, and they believe they can succeed with the language. Task 5 – List the levels of language ability that learners are often grouped into and give a brief summation of each level: beginner – from zero knowledge of English to a very basic one which cannot be quickly or easily activated. elementary – students are able to form basic sentence structures and communicate on simple topics. low/pre-intermediate – able to communicate and understand a great variety of topics but lacking general fluency and depth of language awareness. still likely to make many errors even with basic structures. intermediate – able to understand and communicate on a wide range of issues using limited vocabulary store but still lacking in accuracy and fluency. upper intermediate – should be able to actively communicate on almost all topics using a great range of language but still lacking in accuracy. advanced – students should have a very good knowledge of the English language and now will be studying more suitable language items. Task 6 – Give as many reasons as possible why students are motivated to study English. The reasons that you give do not have to be in the unit reading material. students are motivated to study English because they realize that English is an international language and you can communicate with almost everyobody all over the world using this language. they know English can improve their future career prospects. they realize it can make their travel abroad much easier. they also want to study English to improve their grades and achieve success in exams. they study because they want to communicate with prints, parents, colleagues. very often they just want to learn language because they are interested in English and English culture.

Essay on Breaking Down Foundations

Essay on Breaking Down Foundations Essay on Breaking Down Foundations Anne-Robert-Jacques Turgot’s article Foundations was published in 1757 and was a very radical way of thinking for the time. Turgot discusses his opinion on â€Å"foundations† which involved corporate charities that were created to aid the community. He felt the underlying motives of the charities were aimed solely to the benefit of the founder and their self-worth, and not to fixing the true problems that were present and all the more increasing with these foundations. He also discusses how these charities change over time and the negative effect it has. Turgot then presents his ideas on what we should do to end â€Å"foundations†, and what should be done instead to further the public good. Turgot felt that charities may have had good intentions but there was more harm caused in the long run than any benefit and claimed, â€Å"Is it not very easy to do harm in wishing to do good†. Because most of these charities looked to have good intentions the public wa s blind to the ill that would come to society as a result. He points out, â€Å"misery is most common and most widespread in precisely the countries where these charitable resources are most abundantly available†. When we provide free subsistence we subsidize idleness according to Turgot. As we give to the poor and create free services we give them no desire to improve upon themselves. There is no desire to work when you can get what you need for free. This attitude which was stimulated by the charities created more beggars and loafers. There was also an example given of the establishment of the houses of asylum for repentant women. These houses were set up to provide shelter for women that were former prostitutes. They would need to provide proof of their debauched life to be accepted. This charity did nothing to prevent the cause of debauchery which was the true issue, but overlooked this and provided a means of housing for prostitutes. If anything this would encourage pros titution as after participating in such debauchery they would then have somewhere to go and be accepted. This cause and effect relation that Turgot implies is resulting from charities is further solidified when he provides an analogy of charity provided to a well-run state with no poor, â€Å"An institution offering free assistance to a certain number of men would soon create some poor†. These charities will break down a state, creating more beggars and thus increasing crime and hurting the overall good of society. Turgot felt over time charities begin to break down and it is impossible to maintain their function, stating â€Å"There is no body that has not in the long run lost the sense of its original purpose†. He felt with time we start to do things by habit and lose the original desire we once had. He references how we feel when we first visit a hospital and the feeling you have toward humanity and the emotions toward the people in misery. With habit the workers in the hospital lose this feeling and he observes their lack of concern toward the patients as they carry out their daily duties. The original enthusiasm that was once had is lost with habit according to Turgot. As a result the purpose of a foundation cannot be fulfilled continuously and idleness is created. This idleness that Turgot refers to creates inaction. This has a trickle effect through the management of the foundation, each becoming less likely to take any action to expose any issues within the foundation. Any monetary interest will supersede taking any action as profit has become the aspect of the foundation. This creates a cycle of foundations that are degenerated and then replaced again and again, instead of being changed for the better. The founders obviously take more concern to the distinction that comes with creating new foundations. The other issue according to Turgot is that needs change over time so what was once

What Would Bacon Say Essays

What Would Bacon Say Essays What Would Bacon Say Essay What Would Bacon Say Essay Justice, at what costs should it come? Revenge, is it really that sweet? Justice is a civilized action or way of making someone accountable for their wrongful actions, and leaves it at that. Revenge is a selfish action that brings a person’s personal justice to one’s wrong-doer, where it can spiral into an uncontrolled cycle. Both bring consequences to one’s actions, and yet they are one in the same.According to Francis Bacon, the Colonel set up his own justice for his people through revenge. Justice is actually only mentioned once in his essay, and that is just in the first line: â€Å"Revenge is a kind of wild justice,† (597) this statement shows that revenge and justice are one in the same. They both describe each other, saying that revenge is justice. It is viewed mainly as opposites because of the content at which people think of them. When justice is thought of usually people begin to think about courts, lawyers, judges, that sort of picture.Whereas this is not the case, now law on the other hand fits a bit better. Laws are the actual rules or guidelines that must be followed or if not followed justice will take place. Revenge on the other hand is viewed as a dark, devious, sneaky way of getting back at someone for doing something wrong to a person. Justice/Law is a civilized, organized, and non-personal way to handle matters. So stating that revenge is a wild justice it shows that revenge is not civilized, it is more of a primitive and non-productive way to handle a situation.It is more of a personal, greedy way of handling a situation; taking a situation into their own hands. Yet when situations become to a certain personal point people believe that revenge is acceptable justice. According to Bacon this is not true. He states that taking revenge and becoming even with someone is not productive and wise, â€Å"Certainly in taking revenge, a man is but even with his enemy, but in passing it over, he is superior, for it is a prince’s part to pardon. † (597) He later goes on to state that those who are wise do not ocus on the past because what is in the past can not be changed, and that they have to much to focus about in the present and future. When focusing on the past, it won’t give time to let old wounds heal. Other wise someone who uses law heals that wound and moves on to better things. Bacon then goes on to state that the only tolerable revenge is a public one, where there is no law to follow. He uses Caesar’s death as an example, showing that because he had been murdered there was no law because it was more of a dictatorship; therefore there was no solid law in the land that could follow the assignation of him.So when people obtained revenge for Caesar’s death it restored order and law, and therefore there was no law to punish those who got revenge for Caesar’s death because it had restored order. Now the dictator in Carolyn Forcheâ⠂¬â„¢s piece, â€Å"The Colonel†, is not quite the same as Caesar was, he was a bit more on the harsh side. In this very vivid depiction of the Colonel’s house and his surrounding it is shown that he lives in a life of constant threat. From the bars on his windows, to the lights in and around his house it shows the fear that he holds inside.From the glass on the floor and in the wall, to the pistol that remains next to him, to the ears that he keeps in a paper bag it is shown that he lives a life of violence as well. The Colonel is surrounded by all this fear and violence that it seems like that is all he knows. He was obviously previously served his time in the military because he is addressed as the Colonel, and also that violence is the only way to deal with a situation. Many people who serve the military become so engulfed in a vengeful way of doing things that they view that getting revenge and violence is the best way to handle a situation.Now that the Colonel ha s power over his land he resorts to revenge to get his point across to his people and through that justice is established (according to him). Forche reveals that, â€Å"He spilled many human ears on the table. † (Forche ll. 16) showing that when his people aren’t obeying is point of view he gets revenge, a â€Å"wild justice†, to keep is land in order. The Colonel is affirming what Bacon had stated, that revenge is a selfish act and it is done for one’s own profit, pleasure, or honor. The Colonel exclaims, â€Å"As for the rights of your people, tell them they can go fuck themselves,† (ll. 0-21) showing that his anger towards his people. It shows that the Colonel is focusing on his past because he seems to keep using revenge to try and obtain justice for those whom disobey him. The Colonel reveals that he isn’t that much of a wise person because if he were wise then he would not be focusing on things in the future, according to Bacon. So the Colonel, through Bacon’s eyes, is a vengeful person who will never be able to become a wise governing power, instead he dwells on the past and keeps wounds fresh through his acts of revenge.It is seen time and time again that revenge and bringing justice into one’s own hands becomes a spiraling vortex that may never end. If a person takes revenge then that person will most likely receive revenge as well, and this will keep on going back and forth and won’t ever stop. Just like in Forche’s poem, if revenged had stopped because for some strange reason the Colonel’s way worked then he would have a pistol by him, and bars on the windows. Revenge and Justice are one in the same. Through revenge one can obtain a personal, more selfish justice where law brings a justice that is true and fair.The act of getting revenge does nothing for one’s character, because through revenge you remain on the same level as the person and may never rise above them. The Colonel shows that through revenge one may never become wise and be stuck in a devastating cycle. According to Francis Bacon, the Colonel set up his own justice for his people through revenge. Bacon, Francis. â€Å"Of Revenge. † In Missy James and Alan Merickel, Reading Liturature and Writing Argument. 4th Ed. Upper Saddle River, NJ: Prentice-Hall 2011: 597. Carolyn, Forche. â€Å"The Colonel. † Reading Literature and Writing Argument: 581-582.

Gene Analysis Essay Example | Topics and Well Written Essays - 1000 words

Gene Analysis - Essay Example Gene therapy, integrating vectors carrying therapeutic transgene sequences offers the potential for a permanent cure of genetic diseases by stable vector insertion into the patients chromosomes (1). However there are some reports indicating occurrence of tumors at later stage in transgenic animal and that's why it is important to know probability of non specific integration of this transgene and its effect on cellular homeostasis. As per the present understanding the integration is semi-random in nature and having partial preference towards sequences in or near the coding regions of expressed genes (1). Integration in these places may lead to up or down regulation of that particular gene and hence increase the probability of interference in cellular homeostasis. Based on above observations, it is highly recommended to verify the insertion loci of given vectors in model system. Based on bio-informatical analysis of given sequence, we were able to demonstrated that Viral vector integra tes in vicinity to gene called Nfib (Nuclear factor I/B) and interferes with it normal functioning. Detailed investigation and database search indicates Nfib has potential role in cell cycle regulation and oncogenesis. Vectors, transfection, cloning, amplification and sequencing were performed as per previously mention protocol (1). For identification of gene and its functionality sequence was BLAST against the Mouse genome database (http://www.ncbi.nlm.nih.gov/genome/seq/BlastGen/BlastGen.cgitaxid=10090). Similarly for further verification, sequence was BLAT (http://genome.brc.mcw.edu/cgi-bin/hgBlat) and also compared in RTCGD (http://rtcgd.abcc.ncifcrf.gov/). , to investigate presence of similar gene entry in the data base. GeneSequence: 5'AAAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAATAATAAA AGACAGCCAGTTGAAGGAAGATTTTTTTTTTTCAATT 3' Results and discussion: The sequence was used for similarity search by BLAST in mouse genome database. All the default parameters were kept without changing for identification of match. Fig 1 shows results obtained after BLAST of given sequence. FIG 1: BLAST results >ref|NT_039260.7|Mm4_39300_37 Mus musculus chromosome 4 genomic contig, strain C57BL/6J Length=28591323 Features in this part of subject sequence: nuclear factor I/B Score = 191 bits (103), Expect = 1e-46 Identities = 103/103 (100%), Gaps = 0/103 (0%) Strand=Plus/Plus Query 2 AAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAAT 61 Sbjct 21590158 AAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAAT 21590217 Query 62 AATAAAAGACAGCCAGTTGAAGGAAGAtttttttttttCAATT 104 Sbjct 21590218 AATAAAAGACAGCCAGTTGAAGGAAGATTTTTTTTTTTCAATT 21590260 As seen above, 100% matching were obtained with very low E values (1e-46) which clearly indicates the given sequence belongs to gene called nfib (Nuclear factor I/B). It is located on chromosome 4 (Chr4:81761404-82176981 bp, - strand). Nfib is member of protein family having diverged role in transcription and cell cycle regulation.Similarly BLAT analysis retrieves same gene against the query of given sequence.

Queer Essay Example | Topics and Well Written Essays - 1250 words

Queer - Essay Example The most common being those of homophobia because the word queer means deviant sexual practices that are frowned upon by the society. It can also mean strange sexual characteristics ranging from being a hamerphrodite to having abnormal genitalia. When an individual is not a heterosexual as the society dictates, then that person is referred to as a queer for being a lesbian or gay. Those people who have changed from being female to being males or vice versa are also regarded as queers by the society. The society we live in chooses to assign the word queer to this group of persons because they do not conform to the accepted gender roles assigned to them by the community. Gender has been divided since time in memorial into two groups. According to Bornstein, â€Å"choice between two of something is not a choice, but rather the opportunity to subscribe to the value system which holds the two presented choices as mutually exclusive alternatives and our choice puts us into the system that perpetuates the binary† (Bornstein 101). Different cultures assert that we belong to either one of the two chosen genders without question. If a person chooses not to belong to any of the two, then they are branded as outcasts. Bornstein wonders if the bi-polar gender system were a group and if its members were following rules that they can neither question nor be capable of challenging making group become more like a cult (Bornstein 103). In this context, gender is made up to look like a club for the privileged where the members, exhibit patterns both structural and behavioral that are common to cults (Bornstein 103). In his book â€Å"The Trouble with the Normal†, Warner says â€Å"even after fifty years of resistance, loathing for queer sex, like loathing for gender non conformity remains powerful†(Warner 48). This illustrates the society’s unwillingness to accept those who do not practice what their culture dictates as normal, especially if they are t o be accepted under consideration of sex only. The lesbian and gay movement in America was expected to shed more light on sexuality, but it did not because according to Warner in his book it shows that even after these â€Å"queer† people declared their sexual orientation to the public, they did not get the reaction they expected from â€Å"straight† people as envisioned. The end to stigmatization that they were used to did not end, but it, in fact, escalated because the abuses and threats now had a defined target (Warner 50). In his book, Warner uses the term queer to stand for the sexual acts that gays and lesbians engage in, it is also used to represent those who are sexually oriented towards homosexuality. Queers are understood to be separate from the other part of the population, and their political rights activist movements advocate that they be considered under the minority or special group category. The society we live in makes it hard for these people to be as similated into the community and be perceived as normal because it needs a group to dominate, have power over and control. Even if, the gays and lesbian movements did not arise, the culture we practice has always had a way of isolating an element in a society that is portrayed as queer so that there can be something for the society to frown upon and discriminate. The culture we live in, designed gender in such a way that it would